Leguminosae - AgriHelper
About us  |  Why use us?  |  Press  |  Contact us

 

Topic: Leguminosae



  
 Fabaceae (vetches, peas and beans - formerly Leguminosae or Papilionaceae)
Fabaceae (vetches, peas and beans - formerly Leguminosae or Papilionaceae)
(vetches, peas and beans - formerly Leguminosae or Papilionaceae)
http://www.bioimages.org.uk/HTML/T289.HTM   (29 words)

  
 Bibliography of Astragalus
A new Astragalus (Leguminosae) from Argentina, notable for placentation of its seeds.
Gomez-Sosa, E. Astragalus neobarnebyanus (Leguminosae): A new species from Peru.
Chromsome numbers in the Leguminosae II: African species, including phyletic interpretations.
http://ginger.ucdavis.edu/astragalus/bibliography.htm   (2197 words)

  
 Madagascar, Royal Botanic Gardens, Kew: Science and Horticulture: Madagascar: Home Page
The Leguminosae is a large, cosmopolitan family which is important for its many uses from major agricultural food and fodder crops and green manures to medicines and hardwoods.
Brenierea insignis, a relative of the showy genus Bauhinia, has a growth habit with very reduced leaves, and flattened, cladodinous stems which is coral-like, silvery grey and very attractive for cultivation.
Du Puy, D.J. and Labat, J.-N. A new species of Argyrolobium (Leguminosae - Papilionoideae) from Madagascar.
http://www.rbgkew.org.uk/scihort/madagascar/projects/legumes/legumes.htm   (2560 words)

  
 The Botanical Review: Survey of Leguminosae - a study in adaptive radiation.(Chemistry of Cerambycid Host Plants, part ...
Eighty wood samples representing 51 taxa in 33 genera of Leguminosae were collected in the Sinnamary River Basin in Northern French Guiana and evaluated for their fauna of long-horned beetles (Cerambycidae) and their phytochemical constituents.
The cerambycid fauna was assessed using cut branches and trunks that were continuously observed for emerging beetles.
Survey of Leguminosae - a study in adaptive radiation.(Chemistry of Cerambycid Host Plants, part 1)
http://www.highbeam.com/library/doc0.asp?DOCID=1G1:20383019&refid=ip_encyclopedia_hf   (195 words)

  
 LEGUMINOSAE
These are composed of one large back petal (the standard), two side petals called wings and two lower petals fused together to form a 'keel'.
Flowers ~ Many members of the Leguminosae family have flowers of the typical 'pea' type.
This enables the species to grow and produce crops in poor soil.
http://theseedsite.co.uk/leguminosae.html   (461 words)

  
 phytochemical dictionary of the leguminosae
The Leguminosae is one of the world's most economically important groups of plants, including peas, beans, soya and chickpeas, and provides the world's major source of nitrogen fixed from the atmosphere.
The Phytochemical Dictionary of the Leguminosae is the first of a new type of reference source giving phytochemical records for all legumes (plants in the Pea family - Leguminosae or Fabaceae).
The precise chemical substances found, the organs in which they occur (e.g.
http://www.chipsbooks.com/phytochm.htm   (274 words)

  
 ETI BioInformatics - Flora Malesiana: Leguminosae - Mimosoideae of South-East Asia
The Leguminosae are one of the most important plant families: many species are used as food, green manure or timber.
Flora Malesiana: Leguminosae - Mimosoideae of South-East Asia
ETI BioInformatics - Flora Malesiana: Leguminosae - Mimosoideae of South-East Asia
http://www.eti.uva.nl/Products/catalogue/cd_detail.php?id=28&referrer=catalogue   (280 words)

  
 Small-Subunit rRNA Genotyping of Rhizobia Nodulating Australian Acacia spp. -- Lafay and Burdon 67 (1): 396 -- Applied ...
Polyphasic taxonomy of rhizobia: emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti comb.
Biodiversity of rhizobia isolated from a wide range of forest legumes in Brazil.
Characterisation of rhizobia from African acacias and other tropical woody legumes using Biolog
http://aem.asm.org/cgi/content/full/67/1/396   (3500 words)

  
 IngentaConnect Isozyme Variation in Wild and Cultivated Species of the Genus Tri...
Isozyme Variation in Wild and Cultivated Species of the Genus Trifolium L. (Leguminosae)
http://api.ingentaconnect.com/content/oup/annbot/2000/00000086/00000002/art00339   (282 words)

  
 Structure of Pollen Apertures in the Detarieae sensu stricto (Leguminosae: Caesalpinioideae), with Particular Reference ...
Palynological contribution to the systematics of detarioid legumes (Leguminosae: Caesalpinioideae).
On the development of the pollen grain and anther of some Onagraceae.
Of the three subfamilies in the Leguminosae, the pollen of subfamily
http://aob.oupjournals.org/cgi/content/full/92/3/425   (3511 words)

  
 Shirley C. Tucker- publications
Inflorescence and flower development in wild-type and sid mutant Melilotus alba, white sweetclover.
Effects of epiphytic lichens on host preference of the vascular epiphyte Tillandsia usneoides.
Floral development and homeosis in Saraca (Leguminosae : Caesalpinioideae : Detarieae).
http://www.colorado.edu/eeb/MORPH/labs/pubs/tucker_pubs.html   (483 words)

  
 Dictionary of Plants - Leguminosae
All the native British Leguminosae belong to the Papilionoideae, which includes peas and beans, plants of great importance as a source of protein-rich seeds, also clover and other fodder plants.
The leaves of the Leguminosae bear stipules (outgrowths at the base of the leafstalk) and are often compound, usually pinnately compound, sometimes with tendrils at the leaf tips.
Another distinctive feature of the family is the presence of root nodules containing rhizobium bacteria, which fix atmospheric nitrogen, converting it into forms useful to the plant.
http://www.tiscali.co.uk/reference/dictionaries/plants/data/m0049647.html   (365 words)

  
 The Leguminosae of Madagascar Legumes - botanical books Kew
Of the 573 native species described 459 are unique to the Island whilst 94 appear to have been introduced and naturalised.
The Leguminosae of Madagascar is an encyclopaedic tour de force of one of the largest and most diverse families in the unique flora of Madagascar.
If you wish to be removed from our mailing list click on the REMOVE ME button.
http://www.kewbooks.com/asps/ShowDetails.asp?id=53   (132 words)

  
 A Phylogenomic Investigation of CYCLOIDEA-Like TCP Genes in the Leguminosae -- Citerne et al. 131 (3): 1042 -- PLANT ...
Heterogeneous Selection on LEGCYC Paralogs in Relation to Flower Morphology and the Phylogeny of Lupinus (Leguminosae)
Bruneau A, Forest F, Herendeen PS, Klitgaard BB, Lewis GP (2001) Phylogenetic relationships in the Caesalpinioideae (Leguminosae) as inferred from chloroplast trnL intron sequences.
The Leguminosae is one such plant family where zygomorphy is believed to have evolved separately from the Lamiales (Stebbins,
http://www.plantphysiol.org/cgi/content/full/131/3/1042   (4750 words)

  
 A new exotic pest weevil in South Florida
f.) Irwin and Barneby (Leguminosae); golden dewdrops, Duranta erecta L. (Verbenaceae); grapefruit, Citrus x paradisi Macfad.
(Leguminosae); pygmy date palm, Phoenix roebelenii O'Brien (Palmae); red maple, Acer rubrum L. (Aceraceae); red silk-cotton tree, Bombax ceiba L. (Bombacaceae); rouge plant, Rivina humilis L. (Phytolaccaceae); salt bush, Baccharis halimifolia L. (Compositae); seagrape, Coccoloba uvifera (L.) L. (Polygonaceae); shrubby false buttonweed, Spermacoce verticillata L.
(Ulmaceae); hibiscus, Hibiscus rosa-sinensis L. (Malvaceae); Hong Kong orchid tree, Bauhinia x blakeana S.T. Dunn (Leguminosae); jaboticaba, Myrciaria cauliflora (DC.) O. Berg (Myrtaceae); jambolan plum, Syzygium cuminii (L.) Skeels (Myrtaceae); lantana, Lantana camara L. (Verbenaceae); laurel oak, Quercus laurifolia Michx.
http://www.doacs.state.fl.us/pi/enpp/ento/weevil-pest-alert.htm   (574 words)

  
 Leguminosae,Plants of Central Asia,Plant Collections from China and Mongolia,Plant Genetics, Plant Biology,Plants of ...
Leguminosae,Plants of Central Asia,Plant Collections from China and Mongolia,Plant Genetics, Plant Biology,Plants of China and Mongolia,Text Book of Plants
Genus Caragana, represents the largest and most important group in this volume; Several species of this genus are characteristic of so-called pea shrub steppes.
Covers the treatment of all genera of family Leguminosae except Astragalus and Oxytropis, these being the subject matter of next volume, 8b.
http://www.scipub.net/botany/plants-central-asia-v-8a.html   (113 words)

  
 Leguminosae - Wikipedia, the free encyclopedia
Leguminosae is one of two scientific names allowed for a plant family of close to twenty thousands species.
Thus, Fabaceae will refer to either of two families, which are quite different in size.
The world at large uses Leguminosae for the bigger of these families, but in the US it is preferred to use Fabaceae.
http://en.wikipedia.org/wiki/Leguminosae   (153 words)

  
 Hunt Institute: USDA Drawings 20016 - 20216
20020 U.S.D.A. FOREST SERVICE COLLECTION: Patten, Juliet C. Robinia, Leguminosae
20016 U.S.D.A. FOREST SERVICE COLLECTION: Shull, James M. Robinia, Leguminosae
20017 U.S.D.A. FOREST SERVICE COLLECTION: Shull, James M. Robinia, Leguminosae
http://huntbot.andrew.cmu.edu/USDA/USDA-Drawings-13.html   (2353 words)

  
 Genetic Markers and Quantitative Genetic Variation in Medicago truncatula (Leguminosae): A Comparative Analysis of ...
Genetic Markers and Quantitative Genetic Variation in Medicago truncatula (Leguminosae): A Comparative Analysis of Population Structure
Genetic Markers and Quantitative Genetic Variation in Medicago truncatula (Leguminosae): A Comparative Analysis of Population Structure -- Bonnin et al.
http://www.genetics.org/cgi/content/abstract/143/4/1795   (363 words)

  
 Amazon.ca: Books: Applied Genetics of Leguminosae Biotechnology
Use Your Account to view or change your orders
Written by international experts, these volumes will be of great value to researchers, as well as graduate students and all those requiring an advanced level overview of the subject area.
Top of Page : Applied Genetics of Leguminosae Biotechnology
http://www.amazon.ca/exec/obidos/ASIN/1402014856   (292 words)

  
 IngentaConnect Variation of Nuclear DNA Content in the Biflorus Species of Lonch...
Variation of Nuclear DNA Content in the Biflorus Species of Lonchocarpus (Leguminosae)
http://api.ingentaconnect.com/content/oup/annbot/2000/00000085/00000001/art00069   (262 words)

  
 Reproductive Biology of Butea monosperma (Fabaceae) -- TANDON et al. 92 (5): 715 -- Annals of Botany
Among the Leguminosae, arboreal species are reported to maintain
http://aob.oupjournals.org/cgi/content/full/92/5/715   (4246 words)

  
 BoDD (Botanical Dermatology Database) - LEGUMINOSAE
This species is listed as injurious by Hanslian and Kadlec (1966) but the wood named purpleheart which was described as toxic by Grossmann (1920) is now known to be derived from Peltogyne spp.
Seven of 13 patients contact sensitive to balsam of Peru (from Myroxylon balsamum Harms var pereirae Harms, fam.
Leguminosae) showed positive patch test reactions to balsam of Copaiba.
http://bodd.cf.ac.uk/BotDermFolder/BotDermL/LEGU.html   (11316 words)

  
 Leguminosae
Vernacular names of plants within the Family Leguminosae
[ Leeaceae ] [ Leguminosae ] [ Leitneriaceae ]
http://www.crescentbloom.com/Plants/Familia/L/LEGUMINOSAE.htm   (41 words)

  
 Angiosperm Families - Leguminosae-Mimosoideae Kunth
However, it is clear that the many features which tend to distinguish the subfamilies all involve rather numerous exceptions, are very incompletely documented, or are not universally applicable.
This temporary description reflects incomplete breakdown of esoteric characters across the subfamilies of Leguminosae sensu lato (q.v.).
http://delta-intkey.com/angio/www/mimosoid.htm   (824 words)

  
 Origins, colonization, and lineage recombination in a widespread perennial soybean polyploid complex -- Doyle et al. 96 ...
Multiple Origins and nrDNA Internal Transcribed Spacer Homeologue Evolution in the Glycine tomentella (Leguminosae) Allopolyploid Complex
http://www.pnas.org/cgi/content/abstract/96/19/10741   (478 words)

  
 Case of Localized Recombination in 23S rRNA Genes from Divergent Bradyrhizobium Lineages Associated with Neotropical ...
A phylogeny of the chloroplast gene rbcL in the Leguminosae: taxonomic correlations and insights into the evolution of nodulation.
http://aem.asm.org/cgi/content/full/67/5/2076   (4019 words)

  
 Isely (1981) Leguminosae of the United States, III: Subfamily Papilionoidae, tribes Sophoreae, Podalyrieae, Loteae
Leguminosae of the United States, III: Subfamily Papilionoidae, tribes Sophoreae, Podalyrieae, Loteae
Isely (1981) Leguminosae of the United States, III: Subfamily Papilionoidae, tribes Sophoreae, Podalyrieae, Loteae
http://www.getcited.org/pub/102148391   (26 words)

  
 LEGUMINOSAE - LoveToKnow Article on LEGUMINOSAE
To properly cite this LEGUMINOSAE article in your work, copy the complete reference below:
http://www.1911encyclopedia.org/L/LE/LEGUMINOSAE.htm   (3353 words)

  
 Astragalus gilviflorus
Leguminosae: Answers to key questions in Budd's Flora leading to this family.
http://www.colinherb.com/Leguminosae/Oxytropis/Campestris/Oxytropis_campestris_879_15.htm   (322 words)

  
 Lotus corniculatus Nodulation Specificity Is Changed by the Presence of a Soybean Lectin Gene -- van Rhijn et al. 10 ...
Doyle, J.J., Doyle, J.L., Ballenger, J.A., Dickson, E.E., Kajita, T., and Ohashi, H. (1997) A phylogeny of the chloroplast gene rbcL in the Leguminosae: Taxonomic correlations and insights into the evolution of nodulation.
http://www.plantcell.org/cgi/content/full/10/8/1233   (6218 words)

  
 Lupine - Eiweiß Proteinpflanze Ernährung lupinus Leguminosae Lebensmittel vegetarisch vegan cholesterin lactose ...
Lupinen gehören zur Ordnung der Hülsenfrüchte (Leguminosae), die weltweit mit zahlreichen Gattungen und ca.
Lupine - Eiweiß Proteinpflanze Ernährung lupinus Leguminosae Lebensmittel vegetarisch vegan cholesterin lactose glutenfrei
http://www.biothemen.de/Qualitaet/lupine.html   (1336 words)

  
 PHYTOCHROME SEQUENCES - LEGUMINOSAE
#NEXUS [sites 37-615 or codons 13-205 only are to be analyzed; this data set represents the phytochrome gene family surveyed from the plant family Leguminosae] BEGIN DATA; DIMENSIONS NTAX=117 NCHAR= 579; FORMAT INTERLEAVE MISSING=?
Callerya_australis_A1 TGTGATATGCTGTTGCGAGATGCACCCTTAGGTATTGTATCACAGAGCCCT Callerya_megasperma_A1 TGTGATATGCTGATGCGAGATGCACCCCTAGGAATTGTATCACAGAGCCCT Callerya_australis_A TGTGATATGCTGATGCGAGATGCACCCCTAGGAATTGTTTCACAGAGCCCT Millettia_thonningii_A TGTGATATGCTGATGCGAGATGCACCACTAGGAATTGTATCACAGAGCCCT Millettia_thonningii_A1 TGTGATATGCTGATGCGAGATGCACCACTAGGCATTGTATCACAAAGGCCT Millettia_thonningii_A2 TGTGATATGCTGATGCGAGATGCACCACTAGGCATTGTATCACAAAGGCCT Butea_monosperma_A TGTGATATGCTGATGCGAGATGCACCCCTAGGAATTGTGTCACAGAGCCCT Butea_monosperma_A1 TGTGACATGCTGATGCGAGATGCACCCCTGGGTATTGTATCACAAAGTCCT Butea_monosperma_E TGTGACATGCTCCTTCGAGATGCCCCGTTTGGCATTGTGACTCAATCCCCA Pongamia_pinnata_A TGTGATATGCTGATGCGAGATGCACCACTAGGAATTGTATCACAGAGCCCT Pongamia_pinnata_A1 TGTGATATGCTTATGCGAGATGCTCCACTAGGCATTGTAACACAGAGGCCT Craibia_brevicaudata_A1 TGTGATATGCTGATGCGAGATGCACCCCTAGGTATTGTATCACAGAGCCCT Craibia_brevicaudata_A TGTGATATGCTGATGAGAGATGCACCCCTAGGAATTGTATCACAGAGCCCT ; ENDBLOCK; BEGIN PAUP; OUTGROUP 62-86; ENDBLOCK;
http://www.homepage.montana.edu/~mlavin/data/phy.htm   (811 words)

  
 Estudio preliminar sobre la presencia de bacterias en la raiz de "Gleditsia Amorphoides" (Gris.) Taub. Y "G. ...
Y "G. Triacanthos" L. (Leguminosae) - ROTHSCHILD, D. Search Antiqbook
http://www.antiqbook.com/boox/atn/M02J000086.shtml   (89 words)

  
 Vestured pits in the tribe cassieae bronn (leguminosae) (in MARION)
Click on any of the following to start a new search:
Vestured pits in the tribe cassieae bronn (leguminosae) / by J.T. Quirk and R.B. Miller.
Vestured pits in the tribe cassieae bronn (leguminosae)
http://js-catalog.cpl.org/MARION/BFD-1133   (65 words)

  
 Andreas Kelich: Halluzinogene Rauschdrogen: Botanischer Teil: Andreas Kelich: Leguminosae: Anadenanthera spp.: A. ...
Andreas Kelich: Halluzinogene Rauschdrogen: Botanischer Teil: Andreas Kelich: Leguminosae: Anadenanthera spp.: A. paniculata
http://catbull.com/alamut/Lexikon/Pflanzen/Anadenanthera%20paniculata.htm   (66 words)

  
 Cesamep - Leguminosae - Mimosoideae - R. Br. (1814)
Cesamep - Leguminosae - Mimosoideae - R. Br.
http://www.cesamep.hpg.ig.com.br/legmimos.htm   (8 words)

 About us   |  Why use us?   |  Press   |  Contact us

 Copyright © 2006 AgriHelper.com Usage implies agreement with terms.